Anxa1-P2A-Cre Mouse line

*Anxa1-Cre* knock-in mice express cre recombinase from the mouse *Anxa1* promoter in *Anxa1*-expressing cells and subtypes of dopaminergic neurons. This strain is useful in studies of motor neuron deficits in Parkinson's disease. **Phenotype:** In Parkinson's disease (PD), dopaminergic neurons (DANs) in the midbrain gradually degenerate, with ventral substantia nigra pars compacta (SNc) DANs exhibiting greater vulnerability. The *Anxa1* (annexin A1)-positive subtype of *Sox6* (SRY (sex determining region Y)-box 6 )-positive DANs are selectively lost earlier than other DANs. Specific functional impairment of *Anxa1+* neurons is sufficient to induce slowness of movements and motor tremors, corresponding to the early PD-like symptoms.  *Anxa1-Cre* mice express cre recombinase from the mouse *Anxa1* promoter. Expression of the targeted gene is not disrupted by the knock-in mutation. Heterozygous mice demonstrate no overt phenotype and are fertile. This line can be combined with viral vectors or mouse lines expressing cre recombinase-dependent constructs for selective expression in *Anxa1+* dopaminergic neurons.   **Development:** The TAG stop codon in exon 13 and part of the 3’ UTR of the mouse *Anxa1* gene (ENSMUST00000025561.7) on mouse Chromosome 19 were replaced with a P2A-Cre-rBG (rabbit β-globin polyadenylation signal)-pA cassette using CRISPR/cas9 methodologies in C57BL/6N embryos (gRNA: GACATCCCAACTATTCTGCAAGG). Expression of the targeted gene is not disrupted. Resultant mice were backcrossed to C57BL/6J for more than 10 generations by the donating laboratory. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. [000664](https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256945428%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=k7Z4CAd%2FrrxAMgEYBf2N0qbkw332uHV170dzaT20%2F%2FY%3D&reserved=0 "https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256945428%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=k7Z4CAd%2FrrxAMgEYBf2N0qbkw332uHV170dzaT20%2F%2FY%3D&reserved=0")). ****  **Maintenance:** Heterozygotes are viable and fertile. The donating laboratory maintained this strain through crosses of C57BL/6J females (Stock No. [000664](https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256957732%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=nZfo1l9%2F%2FpmDtXo3sX7A%2FqCtDTZqIs7Md8FE9kS5lcY%3D&reserved=0 "https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256957732%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=nZfo1l9%2F%2FpmDtXo3sX7A%2FqCtDTZqIs7Md8FE9kS5lcY%3D&reserved=0")) with *Anxa1-Cre*heterozygous males. The viability/fertility of homozygotes was not assessed by their group. (January, 2025)