Aligning Science Across Parkinson's Logo Text

Anxa1-P2A-Cre Mouse line

Output Details

*Anxa1-Cre* knock-in mice express cre recombinase from the mouse *Anxa1* promoter in *Anxa1*-expressing cells and subtypes of dopaminergic neurons. This strain is useful in studies of motor neuron deficits in Parkinson's disease. **Phenotype:** In Parkinson's disease (PD), dopaminergic neurons (DANs) in the midbrain gradually degenerate, with ventral substantia nigra pars compacta (SNc) DANs exhibiting greater vulnerability. The *Anxa1* (annexin A1)-positive subtype of *Sox6* (SRY (sex determining region Y)-box 6 )-positive DANs are selectively lost earlier than other DANs. Specific functional impairment of *Anxa1+* neurons is sufficient to induce slowness of movements and motor tremors, corresponding to the early PD-like symptoms.  *Anxa1-Cre* mice express cre recombinase from the mouse *Anxa1* promoter. Expression of the targeted gene is not disrupted by the knock-in mutation. Heterozygous mice demonstrate no overt phenotype and are fertile. This line can be combined with viral vectors or mouse lines expressing cre recombinase-dependent constructs for selective expression in *Anxa1+* dopaminergic neurons.   **Development:** The TAG stop codon in exon 13 and part of the 3’ UTR of the mouse *Anxa1* gene (ENSMUST00000025561.7) on mouse Chromosome 19 were replaced with a P2A-Cre-rBG (rabbit β-globin polyadenylation signal)-pA cassette using CRISPR/cas9 methodologies in C57BL/6N embryos (gRNA: GACATCCCAACTATTCTGCAAGG). Expression of the targeted gene is not disrupted. Resultant mice were backcrossed to C57BL/6J for more than 10 generations by the donating laboratory. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. [000664](https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256945428%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=k7Z4CAd%2FrrxAMgEYBf2N0qbkw332uHV170dzaT20%2F%2FY%3D&reserved=0 "https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256945428%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=k7Z4CAd%2FrrxAMgEYBf2N0qbkw332uHV170dzaT20%2F%2FY%3D&reserved=0")). ****  **Maintenance:** Heterozygotes are viable and fertile. The donating laboratory maintained this strain through crosses of C57BL/6J females (Stock No. [000664](https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256957732%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=nZfo1l9%2F%2FpmDtXo3sX7A%2FqCtDTZqIs7Md8FE9kS5lcY%3D&reserved=0 "https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jax.org%2Fstrain%2F000664&data=05%7C02%7C%7Cfa1c292788e94405f58e08dd453bc69c%7C32669cd6737f4b398bddd6951120d3fc%7C0%7C0%7C638742845256957732%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=nZfo1l9%2F%2FpmDtXo3sX7A%2FqCtDTZqIs7Md8FE9kS5lcY%3D&reserved=0")) with *Anxa1-Cre*heterozygous males. The viability/fertility of homozygotes was not assessed by their group. (January, 2025)
Tags
  • Dopaminergic neurons
  • Mouse
Aligning Science Across Parkinson's
Privacy Overview

This website uses cookies so that we can provide you with the best user experience possible. Cookie information is stored in your browser and performs functions such as recognising you when you return to our website and helping our team to understand which sections of the website you find most interesting and useful.